Orphanet Journal of Rare Diseases - Latest Comments

Corrigendum

Taneli Raivio — 2011-12-06T11:14:02Z

Following the publication of our article [1], we resequenced the first amplicon of exon 2 of CHD7 in proband #16 with a forward primer designed into the 5¿ UTR (TGAAGTGAAGCACAGGCAAG, 42 base pairs upstream of the translation start site) of the gene, because of his semicircular canal hypoplasia and retinal findings, both highly suggestive of a CHD7 mutation [1]. Proband #16 carried a nonsense mutation, c.151C>T (p.Q51X) in CHD7, which explains his phenotype [2]. The results in other probands remain as reported [1].

References
1. Laitinen EM, Vaaralahti K, Tommiska J, Eklund E,Tervaniemi M, Valanne L, Raivio T: Incidence, Phenotypic Features and Molecular Genetics of Kallmann Syndrome in Finland. Orphanet J Rare Dis 2011, 6:41.

2. Kim HG, Kurth I, Lan F, Meliciani I, Wenzel W, Eom SH, Kang GB, Rosenberger G, Tekin M, Ozata M, Bick DP,Sherins RJ, Walker SL, Shi Y, Gusella JF, Layman LC: Mutations in CHD7, encoding a chromatin-remodeling protein, cause idiopathic hypogonadotropic hypogonadism and Kallmann syndrome. Am J Hum Genet 2008, 83:511-519.

looking for more info...

Karen Fredette — 2008-07-09T10:01:52Z

I am a 34 year old woman with Ollier's disease. I have had this disease for longer than I can remember. I have never met anyone else with it either. This is the first article that I've read that explains it in terms that I can understand. This is also the first time I have read an article that speaks what I have been going through thoroughly. I have had about 20 operations on this disease;and I am told that I will always have to have more.

Prevalence of Anorectal malformations

Robert Brian Lowry — 2007-10-23T08:20:08Z

The authors quote a prevalence of 1/5000 live births.This figure is an old one which has been quoted in surgical texts for many years and is likely a hospital based estimate rather than a total population estimate.There are three population studies,two in Canada and a very large one in Europe which have demonstrated rates in the region of twice that quoted ie 1/2200 to 1/2500.

Refs;Am J Med Genet 1986;(Suppl 2): 151-161

ibid 2001;103:207-215

ibid 2002;110:122-130

J Ped Surg 2007;42:1417-1421

The Relation Between Chromosomal Abnormality and Enchondromatosis

Saliha Senel — 2007-05-30T16:37:16Z

The Relation Between Chromosomal Abnormality and Enchondromatosis

Saliha Senel, M.D.Department of pediatrics, Dr Sami Ulus Children’s Hospital, Ankara, TURKEY

Nilufer Karadeniz, M.D. Department of Genetics, Zubeyde Hanım Hospital, Ankara, TURKEY

Emrah Senel, M.D. Department of pediatric surgery, Diskapi Children’s Hospital, Ankara, TURKEY

Correponding author;

Saliha Senel M.D.

Dr Sami Ulus Children’s Hospital, Telsizler ,Ankara, Turkey

Phone: +90 312 3056014

Fax: +90 312 3170353

E mail: drsaliha007@yahoo.com.tr

The Relation Between Chromosomal Abnormality and Enchondromatosis

Dear Editor;

We read with great interest ‘Ollier disease’ in the September 2006 issue of ‘Orphanet journal of rare diseases’in which authors stated that there were no tumor spesific chromosomes or chromosomal regions associated with enchondromas (1).

The relation between enchondromatosis and chromosomal abnormality is not fully known but we think the authors had to mention about the finding of Nakayama et al. that demonstrated an excess of heterochromatin in the q band of the chromosome 1 in a chordoma associated with Maffucci syndrome which is characterized by enchondromas associated with hemangiomas (2).

References:

1.Silve C, Jüppner H. Ollier disease. Orphanet J Rare Dis. 2006;22;1:37.

2. Nakayama Y, Takeno Y, Tsugu H, Tomonaga M. Maffucci’s syndrome associated with intracranial chordoma : a case report. Neurosurgery. 1994;34:907-909.