Orphanet Journal of Rare Diseases - Latest Comments

Equal contributors

Knut Brockmann — 2013-02-22T17:11:56Z

Andreas Ohlenbusch and Simon Edvardson contributed equally to this work. By an oversight this was not designated in the authors´ list.

Women with X-ALD: is it a matter of age?

Ettore Salsano — 2012-12-07T09:39:20Z

The mechanisms underlying the development of clinical manifestations in women with X-ALD are the subject of two articles, one by Maier et al [1], the other by Salsano et al [2], whereas the data by Naidu et al on the topic [3] were unfortunately reported only as congress abstract, making impossible any comparison of results.
According to Maier et al, the development of clinical manifestations in X-ALD female carriers largely depends on the skewed X chromosome inactivation (XCI), leading to the predominant expression of the mutant ABCD1 gene [1]. In contrast, Salsano et al found that the skewed XCI cannot explain the development of symptoms in X-ALD female carriers [2].
In the section ¿Women with X-ALD¿ of their review on X-ALD [4], Engelen et al state that the different result of the work by Salsano et al may be attributable to ¿differences in mean age between the symptomatic and asymptomatic group¿.
Here, I¿d like to stress that our different result should be primarily attributable to the "different methodologies used", as indicated in our article [2]. In fact, the mean age at onset of the symptomatic women is comparable with the mean age at evaluation of the asymptomatic ones (46.0±10.4 vs. 47.5±14.1 years; p = 0.7276, Mann-Whitney test). It is the age at evaluation that was significantly higher in the symptomatic women (62.0±12.1 vs. 47.5±14.1years; p = 0.0199, Mann-Whitney test), but the age at evaluation was significantly higher also in the group of symptomatic women investigated by Maier et al [51.6±9.4 vs. 35±18 years; p=0.0241, Mann-Whitney test] [1]. Moreover, this difference should not cause a significant bias in both the studies, although a growing number of X-ALD women may become symptomatic with increasing age.
It is likely that Maier et al underestimated the degree of XCI skewing in the blood of their cohort of X-ALD females. Actually, the XCI seems to be skewed in the majority of X-ALD females, and - for unknown reasons - the expression of the mutant ABCD1 allele seems to be favored in vivo [2]. This might explain why X-ALD women are more prone to become symptomatic than female carriers of other X-linked diseases, and why Engelen et al have found that ¿the real incidence of AMN in heterozygous women is likely to be close to 65% by the age of 60¿years¿ [4].
However, only a minority of X-ALD women suffer from overt AMN-like symptoms with onset in the 4th or 5th decades. Hence, the development of clinical manifestations should be largely dependent from factors other than the skewed XCI, and it is not surprising that we found a 63-year-old female who was asymptomatic, despite the predominant (93%) expression of the mutant ABCD1 allele (in lymphocytes), and a 73-year-old female who was wheelchair-bound, despite the predominant (62%) expression of the wild-type ABCD1 allele [2].

[1] Maier EM, Kammerer S, Muntau AC, Wichers M, Braun A, Roscher AA. Symptoms in carriers of adrenoleukodystrophy relate to skewed X inactivation. Ann Neurol. 2002, 52:683-688.

[2] Salsano E, Tabano S, Sirchia SM, Colapietro P, Castellotti B, Gellera C, Rimoldi M, Pensato V, Mariotti C, Pareyson D, Miozzo M, Uziel G. Preferential expression of mutant ABCD1 allele is common in adrenoleukodystrophy female carriers but unrelated to clinical symptoms. Orphanet J Rare Dis. 2012, 7:10.

[3] Naidu S, Washington C, Thirumalai S, Smith KD, Moser HW, Watkins PA: X chromosome inactivation in symptomatic heterozygotes of X-linked adrenoleukodystrophy. Ann Neurol 1997, 42:498a

[4] Engelen M, Kemp S, de Visser M, van Geel BM, Wanders RJ, Aubourg PA, Poll-The BT. X-linked adrenoleukodystrophy (X-ALD): clinical presentation and guidelines for diagnosis, follow-up and management. Orphanet J Rare Dis. 2012, 7:51.

Latest guidelines for the treatment of acromegaly

Jon Danzig — 2012-05-30T12:24:15Z

Readers may also be interested to read my comprehensive review and critique of the latest guidelines for the diagnosis and treatment of acromegaly.

http://doiop.com/AcromegalyGuidelines

Corrigendum

Taneli Raivio — 2011-12-06T11:14:02Z

Following the publication of our article [1], we resequenced the first amplicon of exon 2 of CHD7 in proband #16 with a forward primer designed into the 5¿ UTR (TGAAGTGAAGCACAGGCAAG, 42 base pairs upstream of the translation start site) of the gene, because of his semicircular canal hypoplasia and retinal findings, both highly suggestive of a CHD7 mutation [1]. Proband #16 carried a nonsense mutation, c.151C>T (p.Q51X) in CHD7, which explains his phenotype [2]. The results in other probands remain as reported [1].

References
1. Laitinen EM, Vaaralahti K, Tommiska J, Eklund E,Tervaniemi M, Valanne L, Raivio T: Incidence, Phenotypic Features and Molecular Genetics of Kallmann Syndrome in Finland. Orphanet J Rare Dis 2011, 6:41.

2. Kim HG, Kurth I, Lan F, Meliciani I, Wenzel W, Eom SH, Kang GB, Rosenberger G, Tekin M, Ozata M, Bick DP,Sherins RJ, Walker SL, Shi Y, Gusella JF, Layman LC: Mutations in CHD7, encoding a chromatin-remodeling protein, cause idiopathic hypogonadotropic hypogonadism and Kallmann syndrome. Am J Hum Genet 2008, 83:511-519.

looking for more info...

Karen Fredette — 2008-07-09T10:01:52Z

I am a 34 year old woman with Ollier's disease. I have had this disease for longer than I can remember. I have never met anyone else with it either. This is the first article that I've read that explains it in terms that I can understand. This is also the first time I have read an article that speaks what I have been going through thoroughly. I have had about 20 operations on this disease;and I am told that I will always have to have more.

Prevalence of Anorectal malformations

Robert Brian Lowry — 2007-10-23T08:20:08Z

The authors quote a prevalence of 1/5000 live births.This figure is an old one which has been quoted in surgical texts for many years and is likely a hospital based estimate rather than a total population estimate.There are three population studies,two in Canada and a very large one in Europe which have demonstrated rates in the region of twice that quoted ie 1/2200 to 1/2500.

Refs;Am J Med Genet 1986;(Suppl 2): 151-161

ibid 2001;103:207-215

ibid 2002;110:122-130

J Ped Surg 2007;42:1417-1421

The Relation Between Chromosomal Abnormality and Enchondromatosis

Saliha Senel — 2007-05-30T16:37:16Z

The Relation Between Chromosomal Abnormality and Enchondromatosis

Saliha Senel, M.D.Department of pediatrics, Dr Sami Ulus Children’s Hospital, Ankara, TURKEY

Nilufer Karadeniz, M.D. Department of Genetics, Zubeyde Hanım Hospital, Ankara, TURKEY

Emrah Senel, M.D. Department of pediatric surgery, Diskapi Children’s Hospital, Ankara, TURKEY

Correponding author;

Saliha Senel M.D.

Dr Sami Ulus Children’s Hospital, Telsizler ,Ankara, Turkey

Phone: +90 312 3056014

Fax: +90 312 3170353

E mail: drsaliha007@yahoo.com.tr

The Relation Between Chromosomal Abnormality and Enchondromatosis

Dear Editor;

We read with great interest ‘Ollier disease’ in the September 2006 issue of ‘Orphanet journal of rare diseases’in which authors stated that there were no tumor spesific chromosomes or chromosomal regions associated with enchondromas (1).

The relation between enchondromatosis and chromosomal abnormality is not fully known but we think the authors had to mention about the finding of Nakayama et al. that demonstrated an excess of heterochromatin in the q band of the chromosome 1 in a chordoma associated with Maffucci syndrome which is characterized by enchondromas associated with hemangiomas (2).

References:

1.Silve C, Jüppner H. Ollier disease. Orphanet J Rare Dis. 2006;22;1:37.

2. Nakayama Y, Takeno Y, Tsugu H, Tomonaga M. Maffucci’s syndrome associated with intracranial chordoma : a case report. Neurosurgery. 1994;34:907-909.