Research
Incidence, Phenotypic Features and Molecular Genetics of Kallmann Syndrome in Finland
- Equal contributors
Orphanet Journal of Rare Diseases 2011, 6:41 doi:10.1186/1750-1172-6-41
Research
Orphanet Journal of Rare Diseases 2011, 6:41 doi:10.1186/1750-1172-6-41
Corrigendum
Taneli Raivio (2011-12-06 11:14) University of Helsinki, Institute of Biomedicine/Physiology
Following the publication of our article [1], we resequenced the first amplicon of exon 2 of CHD7 in proband #16 with a forward primer designed into the 5�� UTR (TGAAGTGAAGCACAGGCAAG, 42 base pairs upstream of the translation start site) of the gene, because of his semicircular canal hypoplasia and retinal findings, both highly suggestive of a CHD7 mutation [1]. Proband #16 carried a nonsense mutation, c.151C>T (p.Q51X) in CHD7, which explains his phenotype [2]. The results in other probands remain as reported [1].
References
1. Laitinen EM, Vaaralahti K, Tommiska J, Eklund E,Tervaniemi M, Valanne L, Raivio T: Incidence, Phenotypic Features and Molecular Genetics of Kallmann Syndrome in Finland. Orphanet J Rare Dis 2011, 6:41.
2. Kim HG, Kurth I, Lan F, Meliciani I, Wenzel W, Eom SH, Kang GB, Rosenberger G, Tekin M, Ozata M, Bick DP,Sherins RJ, Walker SL, Shi Y, Gusella JF, Layman LC: Mutations in CHD7, encoding a chromatin-remodeling protein, cause idiopathic hypogonadotropic hypogonadism and Kallmann syndrome. Am J Hum Genet 2008, 83:511-519.
Competing interests
The authors have no competing interests.
top